Atf4 kda

Author: oucf

August undefined, 2024

WebAll lanes : Anti-ATF6 antibody (ab83504) at 1 µg/ml Lane 1 : Wild-type HeLa cell lysate Lane 2 : ATF6 knockout HeLa cell lysate Lysates/proteins at 20 µg per lane. Performed under … WebDuring the UPR, PERK can phosphorylate eIF2α, the 90-kDa precursor of ATF6 is cleaved into a 50-kDa protein that functions as a transcription factor, and IRE1 splices a 26-bp intron from Xbp1u, resulting in an active Xbp1s. ... ATF4-F: ATGACCGAAATGAGCTTCCTG: ATF4-R: GCTGGAGAACCCATGAGGT: GADD34-F: GGAGGAAGAGAATCAAGCCA: …

ATF4 Antibody 60035-1-Ig Proteintech

WebA 47 kDa band corresponding to ATF4 was observed in MDA-MB-231, MCF7 and T47D upon cell treatment. Western Blot analysis of ATF4 was performed by separating 30 µg of untreated (–) and treated (+) HeLa whole cell extracts by 10% SDS-PAGE. Proteins were transferred to a membrane and probed with a ATF4 Polyclonal Antibody (Product # … WebDec 10, 2016 · C/EBP-homologous protein, CHOP or GADD153 (growth arrest and DNA damage 153), is another protein induced under conditions of severe ER stress by XBP1 and ATF4 (another UPR component). The 29 kDa CHOP is a member of the C/EBP family of transcription factors. philly truce day

Anti-ATF4 Antibody [S360A-24] Monoclonal IgG2a

WebER stress induces vascular calcification by increasing release of Grp78-loaded EVs. Our results reveal a novel mechanism of action of warfarin, involving increased EV release via the PERK-ATF4 pathway, contributing to calcification. This study is the first to show that warfarin induces ER stress and … WebFeb 28, 2006 · AMSOIL Synthetic Universal ATF / ATF+, ATF+2, ATF+3, ATF+4 _____ Maybe this helps ..... ONLY ATF+4 (or you can consider AMS OIL Synthetic Universal … WebCadmium exposure causes endoplasmic reticulum (ER) stress and accumulation of activating transcription factor 4 (ATF4), an ER stress marker. To elucidate the role of … tsc howell

ATF4 Recombinant Monoclonal Antibody (SD20-92) (MA5-32364)

ATF4 suppresses hepatocarcinogenesis by inducing SLC7A11 …

Web1X10^6 HeLa cells were intracellularly stained with 0.4 ug Anti-Human ATF4 (60035-1-Ig, Clone:3E4C5) and CoraLite®488-Conjugated AffiniPure Goat Anti-Mouse IgG (H+L) at … WebRecent studies have revealed that the central nervous system, particularly the hypothalamus, is critical for regulating insulin sensitivity in peripheral tissues. The aim of our current study is to investigate the possible involvement of hypothalamic activating transcription factor 4 (ATF4) in the r … philly truceWebJan 25, 2024 · Mesenchymal stem cells (MSCs) could be a promising solution in the treatment of various diseases including chronic kidney disease (CKD). However, endoplasmic reticulum (ER) stress induced by ischemia in the area of application limits the integration and survival of MSCs in patients. In our study, we generated ER stress … philly truce app

"WebMar 28, 2024 · Methods. Hepatocyte-specific ATF4 deficient MUP-uPA mice (MUP-uPA/Atf4 Δhep) and control MUP-uPA/Atf4 F/F mice were fed high fat diet (HFD) to induce NASH-induced HCC, and Atf4 F/F and Atf4 Δhep mice were injected with diethylnitrosamine (DEN) to model carcinogen-induced HCC. Histological, biochemical, … " - Atf4 kda

Atf4 kda

Endoplasmic Reticulum Stress Mediates Vascular Smooth Muscle ... - PubMed

WebWestern blot was performed using Anti-ATF4 Polyclonal Antibody (Product # PA5-19521) and a 48 kDa band corresponding to ATF4 was observed across cell lines tested. Whole cell extracts (30 µg lysate) of MCF7 (Lane 1), MCF7 treated with 2 µM Thapsigargin for 8 hours (Lane 2), HeLa (Lane 3) and HeLa treated with 2 µg/ml Tunicamycin for 8 hours ... WebAll lanes : Anti-ATF6 antibody (ab83504) at 1 µg/ml Lane 1 : Wild-type HeLa cell lysate Lane 2 : ATF6 knockout HeLa cell lysate Lysates/proteins at 20 µg per lane. Performed under reducing conditions. Predicted band size: 75 kDa Observed band size: 95 kDa why is the actual band size different from the predicted? Lanes 1- 2: Merged signal (red and …

Did you know?

WebATF4 can bind DNA as a homodimer and as a heterodimer. ATF4 is ubiquitinated by SCF(BTRC) in response to mTORC1 signal, followed by proteasomal degradation and leading to down-regulate expression of SIRT4, so the molecular weight of …

WebWestern blot: Approx 35-37 kDa band observed in Mouse Heart lysates (calculated MW of 38.3 kDa according to Mouse NP_001274109.1; NP_033846.2). ... ATF4 is a transcription factor that was originally identified as a widely expressed mammalian DNA binding protein that could bind a tax-responsive enhancer element in the LTR of HTLV1. The encoded ... WebChromatin immunoprecipitations were performed with cross-linked chromatin from mouse embryonic fibroblasts treated with tunicamycin (2ug/ml) overnight, and ATF-4 (D4B8) …

WebMay 15, 2015 · ATF4 is a transcription factor whose mRNA translation is stimulated in response to stress-activated eIF2alpha kinases. Established conditions that activate eIF2alpha phosphorylation and ATF4 translation include excessive stress in the endoplasmic reticulum (ER) and amino acid deprivation. ... The resulting ~50 kDa His … WebMay 31, 2010 · This suggests that the HIF and BCL2/adenovirus E1B 19-kDa protein-interacting protein 3 pathway may be less important under chronic and severe hypoxia and our results show that ATF4 predominates ...

WebBackground: ATF4. ATF4 is an approximately 38 kDa member of the bzip family of transcription factors. It plays an important role autophagy, the unfolded protein response, …

WebApr 4, 2024 · Part of ATF1-ATF4 transcription factor complex and ATF4-CREB1 transcription factor complex. Is expressed in several structures, including central nervous … tsc hrmsWebMay 31, 2010 · This suggests that the HIF and BCL2/adenovirus E1B 19-kDa protein-interacting protein 3 pathway may be less important under chronic and severe hypoxia … tsch topmodelWebThe antibody recognizes the 38kd ATF4 protein and its phosphorylated forms (50kd). ATF4 can bind DNA as a homodimer and as a heterodimer. ATF4 is ubiquitinated by SCF (BTRC) in response to mTORC1 signal, followed by proteasomal degradation and leading to down-regulate expression of SIRT4, so the molecular weight of ATF4 may be 70 kDa. tschotyWebActivating transcription factor 4 (ATF4), is a stress-induced transcription factor, 1 encoded by the gene mapped to human chromosome 22q13.1. ATF4 is a member of ATF/CREB (cyclic AMP response element binding protein) family of basic region-leucine zipper (bZip) transcription factors. 2. This gene encodes a transcription factor that was ... philly trumpet playersWebThe transcription factor ATF4 enhances bone formation by favoring amino acid import and collagen synthesis in osteoblasts, a function requiring its phosphorylation by RSK2, the kinase inactivated in Coffin-Lowry Syndrome. ... Ribosomal Protein S6 Kinases, 90-kDa / metabolism Substances Amino Acids Atf4 protein, mouse Dietary Proteins ... philly truck linesWebATF4 also regulates glucose homeostasis by suppressing beta-cell proliferation and insulin production. Furthermore, ATF4 targets the histone demethylase JMJD3 to alter chromatin structure and enhance gene transcription in response to amino acid deprivation. ... ~48 kDa observed. The calculated molecular weight is 39 kDa; however, this protein ... philly trumpetWebHowever, CS-11815 detects a band with a mass of ~49 kDa, while the expected molecular weight of ATF4 is ~38 kDa. In contrast, SC-200 is a very dirty polyclonal antibody, but it seems to detect ATF4 as both a ~49 kDa band and a ~38 kDa band. I'm unaware of any long ATF4 splice variants or PTMs that might be responsible for this difference. philly trucking line